logo
Process Patrol

Welcome to my site.
This project was developed by a former Engineer and now a patent agent assistant studding towards LLM degree. Seeing new inventions is very interesting to me. I created this site to outlines my favorite inventions along with inventions that I believe have potential.

Quantification of nucleic acid

by van Gemen, Bob; Kievits, Tim; Lens, Peter F.;



The invention relates to a method for quantification of target nucleic acid in a test sample. A test kit for carrying out said method is also part of the invention.

BACKGROUND OF THE INVENTION

A method for carrying out the amplification of nucleic acid in a test sample has been disclosed among others by Cetus Corp. in U.S. Pat. Nos. 4,683,195 and 4,683,202 the so-called polymerase chain reaction (PCR).

Recently another method for amplification of nucleic acid in a test sample, especially RNA sequences, has been disclosed in European Patent Application EP 0,329,822 by Cangene Corp. now also U.S. Pat. Nos. 5,409,818 and 5,554,517. The process itself will not be discussed here in detail, but it concerns the so-called NASBA technique (= nucleic acid sequence based amplification).

Amplification is an exponential process. Small differences in any of the variables which control the reaction rate will lead to dramatic differences in the yield of the amplified product. PCR as well as NASBA have wide-spread applications in genetic disease diagnosis however, these techniques only provide qualitative results.

A need exists for a method of quantifying directly, accurately, and in a reproducible manner, the amount of a specific nucleic acid present in a test sample.

A sensitive, reproducible, quantitative analysis of a test sample obtained from a patient suffering from an infectious disease, e.g. AIDS or hepatitis, can be of utmost importance in determining the extent of the infectious agent present in the patient, which information is useful in monitoring the patient treatment.

BRIEF DESCRIPTION OF THE INVENTION

The present invention provides a method of quantifying a target nucleic acid in a test sample comprising adding a known number of molecules of a corresponding nucleic acid comprising a well-defined mutant sequence to the test sample, said mutant sequence being discriminatory from the target nucleic acid, but amplifiable with comparable efficiency, subsequently performing an amplification reaction of the nucleic acid, after which quantification of the amplified nucleic acid is performed by differential detection.

The target nucleic acid can be deoxyribonucleic acid (DNA) as well as ribonucleic acid (RNA).

Preferably the target nucleic acid sequence is ribonucleic acid. The differential detection necessary in this method is performed by using a probe sequence able to hybridize with both the target nucleic acid and the mutant sequence as well, or using two probes discriminating the target sequence and mutant sequence.

Said differentiation can also be performed by using a ribozyme capable of cleaving the mutant sequence, while the target sequence will not be cleaved by the ribozyme used or vice versa.

A part of the invention includes a test kit for carrying out the previously described methods.

BRIEF DESCRIPTION OF THE FIGURES

FIGS. 1, 2 and 3 are graphs of the results of competitive NASBA reactions, with a variance of input molecules.

FIGS. 4, 5 and 6 give the results of quantitative NASBA when applied to three sero-positive HIV-1 patient samples.

FIG. 7 is a graph of the results of a competitive NASBA reaction.

DETAILED DESCRIPTION OF THE INVENTION

Recently patent application WO 91/02817 was published in which a co-amplification of an internal standard nucleic acid segment and target sequence was described. The method used in this application is not a competition reaction. In contrast to the instant invention quantification in that application is performed by measuring the signals obtained and subsequently determining the ratio between both sequences amplified. The present invention differs significantly from that process since, among other things, competition between wild-type (target nucleic acid) and well-defined mutant sequence is an essential part of the instant invention.

The method according to the instant invention is based on the principle of competitive amplification of nucleic acid from a clinical sample containing an unknown concentration of wild-type target nucleic acid, to which has been added a known amount of a well-defined mutant sequence.

Amplification of both target nucleic acid and mutant sequence as well is preferably performed with one primer set including two primers of which each primer hybridizes to the target nucleic acid and mutant sequence with the same efficiency.

This competitive amplification is performed with a fixed amount of (clinical) sample and dilution series of mutant sequence or vice versa.

The mutation in the added sequence is necessary for discriminatory detection of the wild-type and mutated amplified sequences with wild-type and mutation specific labelled oligonucleotides respectively.

This means that after competitive amplification samples are analysed in duplo using any sequence specific detection, for example:

1. gel electrophoresis, blotting, hybridization, autoradiography, scanning;

2. Slot-blotting, hybridization, autoradiography, scanning.;

3. Non-capture bead based assay, counting; and

4. Capture bead based assay, counting.

The initial ratio of wild-type and mutated sequences will be reflected in the ratio of wild-type and mutated signals. At a 1:1 ratio and equal efficiency of amplification, the reduction in signal for both wild-type and mutated sequence will be 50%. So at the dilution of mutated nucleic acid that causes a 50% reduction in signal the amount of mutated nucleic acid equals the amount of wild-type nucleic acid in the (clinical) sample.

Using a well-defined mutant sequence comprising, for instance, in the sequence a single base mutation (e.g. an A.fwdarw.G transition) just one restriction enzyme, or a ribozyme, has to be used to discriminate between target nucleic acid and the mutant sequence.

Subsequently just one analysis (for instance one gel system) is necessary in order to quantify the target nucleic acid.

Samples suitable for analysis by this method may be of human or non-human origin. The samples may be derived from cultured samples, for instance, mononuclear cells, or isolated from dissected tissue. Also blood and blood plasma, as well as brain-liquor, urine, etc. can be used as test sample material.

If, for example, the test sample is blood with a target virus to be quantified according to the invention, the viral nucleic acid can be extracted from the test sample. In order to obtain a very fast, simple and reproducible procedure according to the invention the well-defined mutant sequence can be added before, during or after the target nucleic acid extraction without interference in the extraction procedure. Subsequently the competitive amplification and differential detection according to the invention can be performed directly after the extraction procedure.

Due to its high sensitivity, speed, reproducibility and accuracy, the present method can be used to quantify exactly the amount of, for instance, viruses like AIDS-VIRUS or hepatitis virus in the test sample obtained from a patient suspected of suffering from the disease.

It can be of prime importance to know at different stages in a disease the exact amount of viruses or other disease-causing agents in order, for example, to know the dose of medication to be administered to the patient.

The test kit according to the invention is provided in its simplest embodiment with a well-defined mutant sequence and appropriate oligonucleotides viz. primers/primer pair in order to perform the desired amplification reaction and a probe sequence or ribozyme as well.

Additionally, a test kit can be supplied with the appropiate enzymes in order to carry out the amplification reaction.

The method according to the invention is illustrated by the following examples.

EXAMPLE I

In vitro generated wild-type (WT) and mutant (Q) RNA were used to prove the principle of quantitative NASBA. Plasmids used for in vitro RNA synthesis contained a 1416 bp fragment of the HIV-1 sequence resulting from a partial Fok 1 restriction enzyme digest (nucleotides 1186-2638 of the HIV-1hxb2 sequence, Ratner et al., 1987) cloned in pGEM3 or pGEM4 (Promega). The sequence between the restriction sites PstI (position 1418 on HIV-1 hxb2) and Sph I (position 1446 on HIV-1 hxb2) was changed from GAATGGGATAGAGTGCATCCAGTGCATG (OT309) (SEQ ID NO:1) in the WT to GACAGTGTAGATAGATGACAGTCGCATG (OT321) (SEQ ID NO:2) in the Q RNA. In vitro RNA was generated from these constructs with either T7 RNA polymerase or SP6 RNA polymerase. (Sambrook et al., 1989).

Reaction mixtures were treated with DNase to remove plasmid DNA. After phenol extraction and ethanol precipitation the recovered RNA was quantitated on ethidium bromide stained agarose gels by comparison to a calibration series of known amounts of ribosomal RNA. The RNA solutions were diluted to the desired concentrations and used as input for amplification by NASBA as described in EP 0329,822 (now also U.S. Pat. Nos. 5,409,818 and 5,554,517). Primers used for amplification were OT 270: (AATTCTAATACGACTCACTATAGGGGTGCTATGTCACTTCCCCTTGGTTCTCTCA (SEQ ID NO:3), P1) and OT271 (AGTGGGGGGACATCAAGCAGCCATGCAAA, (SEQ ID NO:4) P2), generating a RNA molecule complementary to the HIV-1hxb2 sequence of 142 nt (pos 1357 to 1499). Detection of 10 .mu.l of each amplification has been performed by electrophoresis in duplo on 3% NuSieve, 1% agarose gels (Sambrook et al., 1989) blotted onto Zeta-Probe (Biorad) using a vacuumblot apparatus (Pharmacia) and hybridized with .sup.32 p labelled oligonucleotides specific for either the WT or the Q RNA sequence between above mentioned Sph1 and Pst 1 sites. Exposure times to X-ray films (Kodak) ranged from 30 minutes to 3 days.


Cardiac valve prosthesis Hand-held coating-dispensing apparatus
Data card reader Gas passage shifting device
Protective coating Piston ring
Stencil printing machine Excitatory amino acid derivatives
Movable connecting construction Chassis for electronic components
Soluble azole antifungal salt Hydrofluorocarbon compositions
Highly efficient cement dispersants Ice scraper with retractable cord
Derailleur guard Electromagnetic relay
Image recording device Liquid brace
Connector with fitting confirmation device Image processing system
Personal watercraft Surgical access device
Talking doll having extendible appendages Squeeze dispenser having refill cartridge
Light receiving and reflecting device Rubberized coal tar pitch emulsion
Electronic typewriter Push releasable magnetic latch
Cooling electromagnetic stirrers Plastic container and non-integral handle
4-benzyl-1H-indoles and anti-arrthymic use thereof Optical light probe
Filtering apparatus Carpet cleaning implement
Method for promoting hematopoiesis Antihistaminic substance of stevia origin
Dynamic semiconductor memory device Disk initialization method
Catalysts Septic tank

Films were scanned with a LKB Ultroscan XL densitometer for quantification of the signal in the bands. Number of target molecules of both WT and Q RNA are listed in table 1.

                  TABLE 1
    ______________________________________
    Tube       Copies W.T. RNA
                            Copies Q RNA
    ______________________________________
    1          10.sup.3     10.sup.1
    2          10.sup.3     10.sup.2
    3          10.sup.3     10.sup.3
    4          10.sup.3     10.sup.4
    5          10.sup.3     10.sup.5
    ______________________________________


As control amplification of WT RNA or Q RNA alone was performed. The results of the competitive NASBA are presented in FIG. 1. At the mean of the 50% reduction for both WT and Q RNA the number of input molecules is approximately 10.sup.3 molecules Q RNA, which equals the number of WT RNA molecules.

The formula used for determining the mean of 50% reduction for both Q and WT RNA is as follows: ##EQU1## in which (›Q! 50% Sig. Q) is the number of Q RNA molecules at which the signal using OT 321, specific for Q RNA, is only 50% of the signal obtained when Q RNA alone is amplified and (›Q! 50% Sig. WT) is the number of Q RNA molecules at which the signal using OT 309, specific for WT RNA, is only 50% of the signal obtained when WT RNA alone is amplified.

EXAMPLE II

This experiment was performed the same way as was example 1, except that the input RNA molecules are those given in Table 2 below

                  TABLE 2
    ______________________________________
    Tube        copies W.T. RNA
                            copies Q RNA
    ______________________________________
    1           10.sup.4    10.sup.2
    2           10.sup.4    10.sup.3
    3           10.sup.4    10.sup.4
    4           10.sup.4    10.sup.5
    5           10.sup.4    10.sup.6
    ______________________________________


The results presented in FIG. 2 show an input of 10.sup.4 molecules of WT RNA using the formula. ##EQU2##

EXAMPLE III

This experiment was performed the same way as was example 1, except that the input RNA molecules are those given in Table 3 below.

                  TABLE 3
    ______________________________________
    Tube        copies W.T. RNA
                            copies Q RNA
    ______________________________________
    1           10.sup.5    10.sup.3
    2           10.sup.5    10.sup.4
    3           10.sup.5    10.sup.5
    4           10.sup.5    10.sup.6
    5           10.sup.5    10.sup.7
    ______________________________________


The results presented in FIG. 3 show an input of 6.5.times.10.sup.4 molecules of WT RNA using the formula. ##EQU3##

EAMPLE IV

Here quantitative NASBA is applied to nucleic acid isolated from plasma of HIV-1 infected individuals. 1 ml plasma samples of 3 sero-positive HIV-1 infected individuals were used to isolate nucleic acid (Boom et al., 1990).

Nucleic acid was finally recovered in 100 .mu.l water. Amplifications were as in example 1 except input RNA molecules were as in table 4.

                  TABLE 4
    ______________________________________
    tube      volume nucleic acid sol.
                             copies Q RNA
    ______________________________________
    1         2 .mu.l patient 1
                             10.sup.1
    2         2 .mu.l patient 1
                             10.sup.2
    3         2 .mu.l patient 1
                             10.sup.3
    4         2 .mu.l patient 1
                             10.sup.4
    5         2 .mu.l patient 1
                             10.sup.5
    6         2 .mu.l patient 2
                             10.sup.1
    7         2 .mu.l patient 2
                             10.sup.2
    8         2 .mu.l patient 2
                             10.sup.3
    9         2 .mu.l patient 2
                             10.sup.4
    10        2 .mu.l patient 2
                             10.sup.5
    11        2 .mu.l patient 3
                             10.sup.1
    12        2 .mu.l patient 3
                             10.sup.2
    13        2 .mu.l patient 3
                             10.sup.3
    14        2 .mu.l patient 3
                             10.sup.4
    15        2 .mu.l patient 3
                             10.sup.5
    ______________________________________


Results are presented in FIGS. 4, 5 and 6 for patients 1, 2 and 3, respectively.

Results indicate the number of W.T. RNA molecules patients 1, 2 and 3 to be 4.5.times.10.sup.3, 2.1.times.10.sup.3 and 1.2.times.10.sup.4 in 2 .mu.l nucleic acid solution, respectively, using the formula: ##EQU4##

EXAMPLE V

This experiment was performed the same way as was example 1 except that the input RNA molecules are as shown in table 5 and that detection of NASBA amplified WT.sup.- and Q-RNA is according to the hereafter described method.

Amplified WT.sup.- and Q-RNA of 5 .mu.l NASBA reaction was captured on streptavadin coated magnetic dynabeads (Dynal) with the biotinylated oligonucleotide OT 700 (5' Biotin-TGTTAAAAGAGACCHTCAATGAGGA 3') (SEQ ID NO:5) as intermediair. The capture hybridization process takes place at 45.degree. C. for 30 minutes in 100 .mu.l hybridization buffer II (5.times.SSPE, 0.1% SDS, 0.1% milkpowder, 10 .mu.g/ml denatured salm-sperm DNA; Sambrook et al., 1989). After this step the beads are washed in 2.times.SSC, 0.1% BSA using a magnet to retain the beads in the reaction tube or microtiter plate.

Subsequently the RNA was hybridized with Horse Radish Peroxidase (HRP) labelled oligonucleotides specific for the WT.sup.- or Q-RNA sequence between before mentioned PstI and SphI sites, in 100 .mu.l hybridization buffer II for 30 minutes at 45.degree. C.

Non-hybridized HRP-oligonucleotides are washed away using the same procedure described above. Detection of HRP retained on the beads is accomplished by addition of 100 .mu.l substrate solution (0.45 mM TMB.HCl.H.sub.2 O, 0.5 mM CTAB, 7.65 g/l Emdex, 27 mM NaCitrate.2H.sub.2 O, 22.1 mM citric acid.H.sub.2 O, 2.25 mM urea-peroxid and 5.35 mM 2-chloro-acetamid).

The reaction is stopped at an appropriate time point with 50 .mu.l 250 mM oxalic acid. The amount of substrate conversion from colorless to yellow is determined by measuring the absorbance at 450 nm in an Organon Teknika 510 microplate reader. The A.sub.450 values for both WT.sup.- and Q-probe are analysed as before (FIG. 7).

The results in FIG. 7 show an input of 2.7.times.10.sup.2 molecules WT-RNA using the formula: ##EQU5##

                  TABLE 5
    ______________________________________
    Tube        copies WT.sup.- RNA
                            copies Q-RNA
    ______________________________________
    1           10.sup.2    --
    2           10.sup.2    10.sup.2
    3           10.sup.2    10.sup.3
    4           10.sup.2    10.sup.4
    5           10.sup.2    10.sup.5
    6           10.sup.2    10.sup.6
    ______________________________________


References

Boom R, Sol C F A, Salimans M M M, Jansen C L, Werthiem - van Dillen PME and Van der Noordaa J. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 1990; 28 : 495-503.

Ratner L, Fisher A, Jagodzinske H H, Mitsuya H., Lion R S, Gallo R C and Wong-Staal F. Complete nucleotide sequence of functional clones of the AIDS virus. AIDS Res. Hum. Retroviruses 1987; 3 : 57-69.

Sambrook J, Maniatis T, Fritsch E. Molecular cloning. A laboratory manual, 2nd edition. Cold Spring Harbor laboratories, Cold Spring Habor, N.Y., 1989.

    __________________________________________________________________________
    SEQUENCE LISTING
    (1) GENERAL INFORMATION:
    (iii) NUMBER OF SEQUENCES: 5
    (2) INFORMATION FOR SEQ ID NO:1:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 28 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
    GAATGGGATAGAGTGCATCCAGTGCATG28
    (2) INFORMATION FOR SEQ ID NO:2:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 28 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
    GACAGTGTAGATAGATGACAGTCGCATG28
    (2) INFORMATION FOR SEQ ID NO:3:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 55 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
    AATTCTAATACGACTCACTATAGGGGTGCTATGTCACTTCCCCTTGGTTCTCTCA55
    (2) INFORMATION FOR SEQ ID NO:4:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 29 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
    AGTGGGGGGACATCAAGCAGCCATGCAAA29
    (2) INFORMATION FOR SEQ ID NO:5:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 25 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
    TGTTAAAAGAGACCATCAATGAGGA25
    __________________________________________________________________________